Top » Catalog » SNPs » Y133685

$18.00

Y133685
[Y133685]

Y133685
hg38 Position: ChrY:19902828..19902828
Ancestral: G
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y133685_F AAGTGGGCAAAGGAAATAAGC
Reverse Primer: Y133685_R TCGTTCCAAGTCTTTGCTATTG
Reviews

Customers who bought this product also purchased
Y133711
Y133711
Y133668
Y133668
FGC72524
FGC72524
FGC72518
FGC72518
Y133699
Y133699
R1b Nankivell Group SNP Test
R1b Nankivell Group SNP Test
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies