Top » Catalog » SNPs » FGC5494

$18.00

FGC5494
[FGC5494]

FGC5494
hg38 Position: ChrY:3577073..3577073
Ancestral: A
Derived: G
Reference: Full Genomes Inc (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1l
Comments: Found in a R-DF13 person. above FGC5496; Warning: 99.5% identity with ChrX!
Forward Primer: FGC5494_F CACATTTTTTGTGTCAAAAGCG
Reverse Primer: FGC5494_R TTTGGAATACTCTAGAAAAGAATGCTTC
Reviews

Customers who bought this product also purchased
BY203693
BY203693
S1105
S1105
S1090
S1090
A194
A194
DF27
DF27
A178
A178
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies