Top » Catalog » SNPs » FGC5494

$18.00

FGC5494
[FGC5494]

FGC5494
hg38 Position: ChrY:3577073..3577073
Ancestral: A
Derived: G
Reference: Full Genomes Inc (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1l
Comments: Found in a R-DF13 person. above FGC5496; Warning: 99.5% identity with ChrX!
Forward Primer: FGC5494_F CACATTTTTTGTGTCAAAAGCG
Reverse Primer: FGC5494_R TTTGGAATACTCTAGAAAAGAATGCTTC
Reviews

Customers who bought this product also purchased
A11683
A11683
A761
A761
A10641
A10641
A12590
A12590
BY7804
BY7804
A1149
A1149
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies