Top » Catalog » SNPs » FGC5494

$18.00

FGC5494
[FGC5494]

FGC5494
hg38 Position: ChrY:3577073..3577073
Ancestral: A
Derived: G
Reference: Full Genomes Inc (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1l
Comments: Found in a R-DF13 person. above FGC5496; Warning: 99.5% identity with ChrX!
Forward Primer: FGC5494_F CACATTTTTTGTGTCAAAAGCG
Reverse Primer: FGC5494_R TTTGGAATACTCTAGAAAAGAATGCTTC
Reviews

Customers who bought this product also purchased
BY246
BY246
A2070
A2070
M343
M343
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
A7299
A7299
A7298
A7298
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies