Top » Catalog » SNPs » A958

$18.00

A958
[A958]

A958
hg38 Position: ChrY:20472907..20472907
Ancestral: A
Derived: C
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream of FGC13899
Forward Primer: A958_F CAGAGCCCAGATAGCCTCTG
Reverse Primer: A958_R AGGCCCATTTGAAAGTGTTTC
Reviews

Customers who bought this product also purchased
A977
A977
A236
A236
FGC13914
FGC13914
A976
A976
A235
A235
FGC13899
FGC13899
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies