Top » Catalog » SNPs » A20859

$18.00

A20859
[A20859]

A20859
hg38 Position: ChrY:21457336..21457336
Ancestral: G
Derived: A
Reference: Angelia Roberson (2018)
ISOGG Haplogroup: R1b
Comments: Below FGC11134 > A159
Forward Primer: A20859_F GCTAGATATGGCAATTTTATGTAAGTCTG
Reverse Primer: A20859_R GGTAGGGTATGGCACTGTCAATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies