Top » Catalog » SNPs » A20863

$18.00

A20863
[A20863]

A20863
hg38 Position: ChrY:19311537..19311537
Ancestral: G
Derived: T
Reference: Angelia Roberson (2018)
ISOGG Haplogroup: R1b
Comments: Below FGC11134 > A159
Forward Primer: A20863_F TGGATAGAGTGGCTGAGATGC
Reverse Primer: A20863_R AATGGGTGAAGCACACCAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies