Top » Catalog » SNPs » F24356

$18.00

F24356
[F24356]

F24356
hg38 Position: ChrY:19321886..19321886
Ancestral: G
Derived: T
Reference: Ryan Lan-Hai Wei (2017)
ISOGG Haplogroup: R1b
Comments: Below FGC11134 > A159
Forward Primer: F24356_F AGTTCTCCCAGTCCCCACTC
Reverse Primer: F24356_R CTTTTTGGAAACCCCCTGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies