Top » Catalog » SNPs » A959

$18.00

A959
[A959]

A959
hg38 Position: ChrY:8380305..8380305
Ancestral: A
Derived: C
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream of A228
Forward Primer: A959_F CGTAAGTTCAGGGCCAAGAG
Reverse Primer: A959_R TCCACGACTCCCTTACTGAAG
Reviews

Customers who bought this product also purchased
A964
A964
A968
A968
A551
A551
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
L513
L513
FGC5494
FGC5494
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies