Top » Catalog » SNPs » A959

$18.00

A959
[A959]

A959
hg38 Position: ChrY:8380305..8380305
Ancestral: A
Derived: C
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream of A228
Forward Primer: A959_F CGTAAGTTCAGGGCCAAGAG
Reverse Primer: A959_R TCCACGACTCCCTTACTGAAG
Reviews

Customers who bought this product also purchased
A964
A964
A968
A968
DF21
DF21
DF41
DF41
Z253
Z253
Z255
Z255
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies