Top » Catalog » SNPs » A959

$18.00

A959
[A959]

A959
hg38 Position: ChrY:8380305..8380305
Ancestral: A
Derived: C
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream of A228
Forward Primer: A959_F CGTAAGTTCAGGGCCAAGAG
Reverse Primer: A959_R TCCACGACTCCCTTACTGAAG
Reviews

Customers who bought this product also purchased
A968
A968
A964
A964
L1335
L1335
DF13
DF13
FGC11134
FGC11134
A551
A551
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies