Top » Catalog » SNPs » ZQ303

$18.00

ZQ303
[ZQ303]

ZQ303
hg38 Position: ChrY:8782090..8782090
Ancestral: G
Derived: A
Reference: Gabit Baimbetov [ShejireDNA] (2017)
ISOGG Haplogroup: C2b1a3a
Comments: Below M401
Forward Primer: ZQ303_F AAAAAAAGAAAAATAGACAAGATTAGTGTCG
Reverse Primer: ZQ303_R TTTACTGGTAATAGTAAGTGTAAAATGTTTTC
Reviews

Customers who bought this product also purchased
L14
L14
Z2103
Z2103
PF7562
PF7562
L48
L48
S310
S310
A1277
A1277
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies