Top » Catalog » SNPs » ZQ303

$18.00

ZQ303
[ZQ303]

ZQ303
hg38 Position: ChrY:8782090..8782090
Ancestral: G
Derived: A
Reference: Gabit Baimbetov [ShejireDNA] (2017)
ISOGG Haplogroup: C2b1a3a
Comments: Below M401
Forward Primer: ZQ303_F AAAAAAAGAAAAATAGACAAGATTAGTGTCG
Reverse Primer: ZQ303_R TTTACTGGTAATAGTAAGTGTAAAATGTTTTC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
ZQ304
ZQ304
Z31703
Z31703
Z31707
Z31707
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies