Top » Catalog » SNPs » BY20673

$18.00

BY20673
[BY20673]

BY20673
hg38 Position: ChrY:2870417..2870417
Ancestral: A
Derived: G
Reference: FTDNA (2017)
ISOGG Haplogroup: C
Comments: .
Forward Primer: BY20673_F TGAGCCACAAAATGGGTAAGAC
Reverse Primer: BY20673_R AAGTAAATTGCAGGTTTCACTTAAGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies