Top » Catalog » SNPs » A20936

$18.00

A20936
[A20936]

A20936
hg38 Position: ChrY:13478417..13478417
Ancestral: T
Derived: C
Reference: Zdenko Markovic (2018)
ISOGG Haplogroup: I2
Comments: Below Y14718
Forward Primer: A20936_F ATTTCACGGGACCAATTGAC
Reverse Primer: A20936_R GCTCCTATCAGCCAAGATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies