Top » Catalog » SNPs » A20937

$18.00

A20937
[A20937]

A20937
hg38 Position: ChrY:20027839..20027839
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2018)
ISOGG Haplogroup: I2
Comments: Below Y14718
Forward Primer: A20937_F TGAACCCAGTCCTGGAAATC
Reverse Primer: A20937_R GGAAAGCATTTTCATTTGTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies