Top » Catalog » SNPs » Y132210

$18.00

Y132210
[Y132210]

Y132210
hg38 Position: ChrY:7858305..7858305
Ancestral: C
Derived: T
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: Below FGC10117/FGC10124
Forward Primer: Y132210_F TCCAGAATGAGTCACCATCG
Reverse Primer: Y132210_R AGTTCCCAGGCATGAAGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies