Top » Catalog » SNPs » FGC4369

$18.00

FGC4369
[FGC4369]

FGC4369
hg38 Position: ChrY:8133460..8133460
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2013)
ISOGG Haplogroup: not listed
Comments: unk.
Forward Primer: FGC4369_F TATAGTTGGGACTGCGGTTG
Reverse Primer: FGC4369_R TCCCCTATAAGGAGTCACGTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies