Top » Catalog » SNPs » A20939

$18.00

A20939
[A20939]

A20939
hg38 Position: ChrY:11888435..11888435
Ancestral: C
Derived: N
Reference: Ray Warburton (2018)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A20939_F ATTAGTAGGGCATGACTCCTAAGACC
Reverse Primer: A20939_R CAGATATCCTGAAGCAAGTGAAGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies