Top » Catalog » SNPs » A20941

$18.00

A20941
[A20941]

A20941
hg38 Position: ChrY:14542943..14542943
Ancestral: G
Derived: A
Reference: Don Maxwell (2018)
ISOGG Haplogroup: R1b
Comments: Below FGC5494 > A1284
Forward Primer: A20941_F TCACAATAGCACAGGCTTGG
Reverse Primer: A20941_R TGGGGTACATATGCAGAACG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies