Top » Catalog » SNPs » Y136128

$18.00

Y136128
[Y136128]

Y136128
hg38 Position: ChrY:14716580..14716580
Ancestral: T
Derived: G
Reference: Iain Kennedy (2018)
ISOGG Haplogroup: R1b
Comments: Below Z253/S844
Forward Primer: Y136128_F TGCTGCGAAAACAATTAAAGG
Reverse Primer: Y136128_R TCTCCCAGTTTATGGCTTGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies