Top » Catalog » SNPs » SUR51

$18.00

SUR51
[SUR51]

SUR51
hg38 Position: ChrY:8568323..8568323
Ancestral: A
Derived: G
Reference: Bulat Muratov (2014)
ISOGG Haplogroup: R1a (not listed)
Comments: Approx. Y2632
Forward Primer: SUR51_F CAATTCCATCTCCGCATTTC
Reverse Primer: SUR51_R TTTGTTGGCAGCTGTAATGG
Reviews

Customers who bought this product also purchased
R1a Superclade Panel
R1a Superclade Panel
Y937
Y937
YP4907
YP4907
Y47
Y47
Z93
Z93
L62
L62
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies