Top » Catalog » SNPs » SUR51

$18.00

SUR51
[SUR51]

SUR51
hg38 Position: ChrY:8568323..8568323
Ancestral: A
Derived: G
Reference: Bulat Muratov (2014)
ISOGG Haplogroup: R1a (not listed)
Comments: Approx. Y2632
Forward Primer: SUR51_F CAATTCCATCTCCGCATTTC
Reverse Primer: SUR51_R TTTGTTGGCAGCTGTAATGG
Reviews

Customers who bought this product also purchased
Y79089
Y79089
Z2124
Z2124
Y2633
Y2633
R1a-Z93 Panel
R1a-Z93 Panel
Y2632
Y2632
Y20746
Y20746
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies