Top » Catalog » SNPs » Y133354

$18.00

Y133354
[Y133354]

Y133354
hg38 Position: ChrY:12593537..12593537
Ancestral: T
Derived: C
Reference: YFull (2018)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: Y133354_F TTATGCCCCTATCTGGCAAC
Reverse Primer: Y133354_R CCTTTAGGTGTTATGTAACCTGAGCTAC
Reviews

Customers who bought this product also purchased
Y133364
Y133364
R1a-L1029 Dibra Cluster
R1a-L1029 Dibra Cluster
Y133383
Y133383
A20979
A20979
Y133371
Y133371
A20974
A20974
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies