Top » Catalog » SNPs » Y133386

$18.00

Y133386
[Y133386]

Y133386
hg38 Position: ChrY:14968072..14968072
Ancestral: C
Derived: T
Reference: YFull (2018)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: Y133386_F CTGAGGGCAAGGGATATTACATAC
Reverse Primer: Y133386_R TCAGTAGATCCACCCATCCTTC
Reviews

Customers who bought this product also purchased
Y133383
Y133383
Y133364
Y133364
R1a-L1029 Dibra Cluster
R1a-L1029 Dibra Cluster
Y133361
Y133361
Y133380
Y133380
A20968
A20968
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies