Top » Catalog » SNPs » FGC72053

$18.00

FGC72053
[FGC72053]

FGC72053
hg38 Position: ChrY:16850862..16850862
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC72053_F TGCAGAGGAAGGTCTTCAGG
Reverse Primer: FGC72053_R GGGAGGAAATCCTAACACAGG
Reviews

Customers who bought this product also purchased
A21079
A21079
DYS461
DYS461
DYS504
DYS504
DYS444
DYS444
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies