Top » Catalog » SNPs » A21079

$18.00

A21079
[A21079]

A21079
hg38 Position: ChrY:20562244..20562244
Ancestral: T
Derived: G
Reference: Fred Meek (2018)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A21079_F CAAGTGGAGAGTTCAGCATTTAC
Reverse Primer: A21079_R GAATCCCAAGACTCCCACAG
Reviews

Customers who bought this product also purchased
FGC72053
FGC72053
DYS461
DYS461
DYS504
DYS504
DYS444
DYS444
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies