Top » Catalog » SNPs » A21089

$18.00

A21089
[A21089]

A21089
hg38 Position: ChrY:19385577..19385577
Ancestral: T
Derived: C
Reference: Jef Treece (2018)
ISOGG Haplogroup: R1b
Comments: Downstream P312 > DF27
Forward Primer: A21089_F TCAGCAAGATAATCTTTCATCTCTAATATTC
Reverse Primer: A21089_R AAAAATGTTAAAAACCCAAAAAGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies