Top » Catalog » SNPs » A21090

$18.00

A21090
[A21090]

A21090
hg38 Position: ChrY:13380547..13380547
Ancestral: C
Derived: T
Reference: Jef Treece (2018)
ISOGG Haplogroup: R1b
Comments: Downstream P312 > DF27
Forward Primer: A21090_F TGAGGAAAGAATCTCTCAGCTTG
Reverse Primer: A21090_R GGGTATAAACTCCCTGGTTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies