Top » Catalog » SNPs » A21092

$18.00

A21092
[A21092]

A21092
hg38 Position: ChrY:19650354..19650354
Ancestral: G
Derived: A
Reference: Jef Treece (2018)
ISOGG Haplogroup: R1b
Comments: Downstream P312 > DF27
Forward Primer: A21092_F ACTGTTGAAAGGGCTGTTGC
Reverse Primer: A21092_R TGATGGGTGATGGGAAAGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies