Top » Catalog » SNPs » A21093

$18.00

A21093
[A21093]

A21093
hg38 Position: ChrY:13079766..13079766
Ancestral: C
Derived: T
Reference: Jef Treece (2018)
ISOGG Haplogroup: R1b
Comments: Downstream P312 > DF27
Forward Primer: A21093_F TCTTCTTACCTTTCCCTTTGC
Reverse Primer: A21093_R TTTCTCAGAATTTGGCAGAATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies