Top » Catalog » SNPs » A21103

$18.00

A21103
[A21103]

A21103
hg38 Position: ChrY:7521863..7521863
Ancestral: G
Derived: A
Reference: Jef Treece (2018)
ISOGG Haplogroup: R1b
Comments: Downstream P312 > DF27
Forward Primer: A21103_F CAGGCAATAAATGCACCG
Reverse Primer: A21103_R CTCACTATTATGGGGACAGCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies