Top » Catalog » SNPs » A21105

$18.00

A21105
[A21105]

A21105
hg38 Position: ChrY:8734277..8734277
Ancestral: A
Derived: C
Reference: Jef Treece (2018)
ISOGG Haplogroup: R1b
Comments: Downstream U106 > DF98
Forward Primer: A21105_F TATCCTTATTTTTTTTTTTGCAAGTCAG
Reverse Primer: A21105_R AGGTCACCATTGTGTAGAAAAAAG
Reviews

Customers who bought this product also purchased
A21104
A21104
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies