Top » Catalog » SNPs » A21106

$18.00

A21106
[A21106]

A21106
hg38 Position: ChrY:9126060..9126060
Ancestral: C
Derived: T
Reference: Jef Treece (2018)
ISOGG Haplogroup: R1b
Comments: Downstream U106 > DF98
Forward Primer: A21106_F AAAGTGCTGGGATTACAGGC
Reverse Primer: A21106_R GTTTATTATGTATCTGGGAAAGGAAAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies