Top » Catalog » SNPs » A21107

$18.00

A21107
[A21107]

A21107
hg38 Position: ChrY:21471477..21471477
Ancestral: T
Derived: A
Reference: Jef Treece (2018)
ISOGG Haplogroup: R1b
Comments: Downstream U106 > DF98
Forward Primer: A21107_F CCTTTTCTGGGACAATCAGC
Reverse Primer: A21107_R TGGGCTCAGGAGATCAAGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies