Top » Catalog » SNPs » ALK3

$18.00

ALK3
[ALK3]

ALK3
hg38 Position: ChrY:8165553..8165553
Ancestral: G
Derived: A
Reference: Ahmad Al-Khuraiji (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: ALK3_F CTCATATACCTCACTAAAGTACTCCACATATG
Reverse Primer: ALK3_R CATATAATTTCCAACTTTTTGTATAGAAAGTG
Reviews

Customers who bought this product also purchased
ALK1
ALK1
ALK2
ALK2
ALK4
ALK4
ALK5
ALK5
ALK6
ALK6
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x L829
$18.00
Haplogroup Info
Other products
Currencies