Top » Catalog » SNPs » ALK4

$18.00

ALK4
[ALK4]

ALK4
hg38 Position: ChrY:12925130..12925130
Ancestral: A
Derived: C
Reference: Ahmad Al-Khuraiji (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: ALK4_F CCTGAGTCTCAGGGACCG
Reverse Primer: ALK4_R CACTTATGGCCTGTCATGCC
Reviews

Customers who bought this product also purchased
ALK2
ALK2
ALK3
ALK3
ALK5
ALK5
ALK6
ALK6
Wish a SNP
Wish a SNP
ALK1
ALK1
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies