Top » Catalog » SNPs » Z27034

$18.00

Z27034
[Z27034]

Z27034
hg38 Position: ChrY:15111221..15111221
Ancestral: G
Derived: C
Reference: Ray Banks (2015)
ISOGG Haplogroup: I2a1a1a1a1b
Comments: Below L160 > CTS1758
Forward Primer: Z27034_F CGTCTTCTGCCTCCTCACG
Reverse Primer: Z27034_R TGGGAGACAAAGTGAGGCAC
Reviews

Customers who bought this product also purchased
Y84185
Y84185
M26
M26
A17271
A17271
A19300
A19300
I2a-CTS595 Panel
I2a-CTS595 Panel
CTS1758
CTS1758
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies