Top » Catalog » SNPs » Z27034

$18.00

Z27034
[Z27034]

Z27034
hg38 Position: ChrY:15111221..15111221
Ancestral: G
Derived: C
Reference: Ray Banks (2015)
ISOGG Haplogroup: I2a1a1a1a1b
Comments: Below L160 > CTS1758
Forward Primer: Z27034_F CGTCTTCTGCCTCCTCACG
Reverse Primer: Z27034_R TGGGAGACAAAGTGAGGCAC
Reviews

Customers who bought this product also purchased
CTS1758
CTS1758
PF4125
PF4125
Y23411
Y23411
Z105
Z105
BY130413
BY130413
Y24017
Y24017
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies