Top » Catalog » SNPs » ZS11543

$18.00

ZS11543
[ZS11543]

ZS11543
hg38 Position: ChrY:16778179..16778179
Ancestral: G
Derived: A
Reference: Victar Mas (2016)
ISOGG Haplogroup: J1
Comments: downstream FGC4355
Forward Primer: ZS11543_F AGGAGAAAGGAAGAGCGGTG
Reverse Primer: ZS11543_R TTCCCAAGTAGTTTAGGGTAAAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies