Top » Catalog » SNPs » BY19000

$18.00

BY19000
[BY19000]

BY19000
hg38 Position: ChrY:8172788..8172788
Ancestral: A
Derived: G
Reference: FTDNA (2017)
ISOGG Haplogroup: unknown
Comments: .
Forward Primer: BY19000_F GGGCAAATAATATATTGATTAACAAGC
Reverse Primer: BY19000_R GGGGACAAAAAAATGTGCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies