Top » Catalog » SNPs » S15732

$18.00

S15732
[S15732]

S15732
hg38 Position: ChrY:12153078..12153078
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: not listed
Comments: .
Forward Primer: S15732_F AACCAAAACCAAACTAGCAAGTG
Reverse Primer: S15732_R GAAGCTCCTGGATGAATAAAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies