Top » Catalog » SNPs » Y88052

$18.00

Y88052
[Y88052]

Y88052
hg38 Position: ChrY:8933893..8933893
Ancestral: C
Derived: A
Reference: YFull (2017)
ISOGG Haplogroup: J2
Comments: .
Forward Primer: Y88052_F GAAAGAAAAGAAAGTTGAGAGCTTC
Reverse Primer: Y88052_R TGAAGGCTACCCTCTGGAGTC
Reviews

Customers who bought this product also purchased
YFS4541454
YFS4541454
YFS4541168
YFS4541168
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies