Top » Catalog » SNPs » YFS4538254

$18.00

YFS4538254
[YFS4538254]

YFS4538254
hg38 Position: ChrY:21439966..21439966
Ancestral: C
Derived: A
Reference: Hassan Alnemer (2017)
ISOGG Haplogroup: J2a
Comments: Below L25 > Z38752 > Z38742
Forward Primer: YFS4538254_F CTCTTTTTGGCTCCATATGAAG
Reverse Primer: YFS4538254_R AAAACCCCACTGTCTGAGCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies