Top » Catalog » SNPs » YFS4538662

$18.00

YFS4538662
[YFS4538662]

YFS4538662
hg38 Position: ChrY:16833361..16833361
Ancestral: G
Derived: A
Reference: Hassan Alnemer (2017)
ISOGG Haplogroup: J2a
Comments: Below L25 > Z38752 > Z38742
Forward Primer: YFS4538662_F GCAGTGATATACTAGGATAGAGGAGAATG
Reverse Primer: YFS4538662_R GTGACTAACTAAGGCCATATTCATCATAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies