Top » Catalog » SNPs » YFS4541454

$18.00

YFS4541454
[YFS4541454]

YFS4541454
hg38 Position: ChrY:20982538..20982538
Ancestral: G
Derived: A
Reference: Hassan Alnemer (2017)
ISOGG Haplogroup: J2a
Comments: Below L25 > Z38752 > Z38742
Forward Primer: YFS4541454_F TTATCCATTTTTTCTAGAATTTCCAGC
Reverse Primer: YFS4541454_R AACAGATATAAAAATGTTCTCTTGAATCC
Reviews

Customers who bought this product also purchased
YFS4541168
YFS4541168
Y88052
Y88052
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies