Top » Catalog » SNPs » YFS4543869

$18.00

YFS4543869
[YFS4543869]

YFS4543869
hg38 Position: ChrY:14638531..14638531
Ancestral: C
Derived: T
Reference: Hassan Alnemer (2017)
ISOGG Haplogroup: J2a
Comments: Below L25 > Z38752 > Z38742
Forward Primer: YFS4543869_F CAGTGTGGGATGTTCCTCTCC
Reverse Primer: YFS4543869_R GATGATGTTTTTGATGATGATAATGATG
Reviews

Customers who bought this product also purchased
DYS572
DYS572
DYS534
DYS534
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies