Top » Catalog » SNPs » CLD98

$18.00

CLD98
[CLD98]

CLD98
hg38 Position: ChrY:16720845..16720845
Ancestral: A
Derived: N
Reference: Clan Donald USA (2018)
ISOGG Haplogroup: R1a
Comments: Downstream S4458 > S5301 > S5153 > L448 > CTS4179 > BY27147
Forward Primer: CLD98_F GTATATGAATTCGTATGTTTTAATTATTTCATC
Reverse Primer: CLD98_R CGGGAACTGGAGGTAGCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies