Top » Catalog » SNPs » A21202

$18.00

A21202
[A21202]

A21202
hg38 Position: ChrY:14509331..14509331
Ancestral: G
Derived: A
Reference: YSEQ (2018)
ISOGG Haplogroup: R1b
Comments: Phylo-equivalent A1720
Forward Primer: A21202_F GACATTATTAAACCTGGCAACCTTC
Reverse Primer: A21202_R ACTTTCAGACACTACAAGAAATGCATAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies