Top » Catalog » SNPs » A21212

$18.00

A21212
[A21212]

A21212
hg38 Position: ChrY:7809928..7809928
Ancestral: C
Derived: T
Reference: Alex Buchanan (2018)
ISOGG Haplogroup: R1b
Comments: Below DF13 > BY39001
Forward Primer: A21212_F ATGTCACAATTTTATATTTTTACAGAAACG
Reverse Primer: A21212_R TTTGACATAGCACAGGGCATATAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies