Top » Catalog » SNPs » A21213

$18.00

A21213
[A21213]

A21213
hg38 Position: ChrY:8879640..8879640
Ancestral: A
Derived: G
Reference: Alex Buchanan (2018)
ISOGG Haplogroup: R1b
Comments: Below DF13 > BY39001
Forward Primer: A21213_F TAGGCAGGACCAGGGATATG
Reverse Primer: A21213_R CAGGTGAAGGAGCAAAAAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies